circad | circRNAs associated with diseases

circDLGAP4/mmu_circ_0001098
Gene	DLGAP4	Organism	Mouse
Genome Locus	chr2:156571570-156575092:+	Build	n/a
Disease	Acute Ischemic Stroke	ICD-10	Cerebral infarction, unspecified (I63.9)
DBLink	Link to database	PMID	29114076
Experimental Method
Sample Type	Plasma sample	Comparison	26 stroke patients and 26 non-stroke controls
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGCCAGATGGACAAGGAGACC Reverse CTGGACGGTGACTGAGATGAA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Bai, Y, Zhang, Y, Han, B, Yang, L, Chen, X, Huang, R, Wu, F, Chao, J, Liu, P, Hu, G, Zhang, JH, Yao, H (2018). Circular RNA DLGAP4 Ameliorates Ischemic Stroke Outcomes by Targeting miR-143 to Regulate Endothelial-Mesenchymal Transition Associated with Blood-Brain Barrier Integrity. J. Neurosci., 38, 1:32-50.